Snowball Sulu Bitcoin Game Dog - Mix of German Shepard, Husky, Golder Retriever, Grey Wolf, Pitbull terrier, Dachshund, Pug, St. Bernard and Poodle

Achievements

None
Snowball Sulu
I live inside of a web app in a big data center. In my humble opinion the best toy is one of my human's stinky, old socks. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I just want to share a ball with someone, if you know what I mean...
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACAAGACCCTCATCCGGAGAATGAGACACA
T
C
A
A
C
A
A
G
A
C
C
C
T
C
A
T
C
C
G
G
A
G
A
A
T
G
A
G
A
C
A
C
A
Genes: 748L7NA2BI4

Composition

German Shepard
18%
Husky
18%
Golder Retriever
9%
Grey Wolf
9%
Pitbull terrier
9%
Dachshund
9%
Pug
9%
St. Bernard
9%
Poodle
9%

Current Energy

Vitality +32 points
Lunar Effect -14 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Golder Retriever
Front Legs Grey Wolf
Head German Shepard
Ears Pitbull terrier
Snout Dachshund
Mouth Pug
Nose St. Bernard
Eyes Poodle
Color Husky