Willow Willy Digital Cryptocurrency Game Dog - Mix of Husky, Border Collie, Poodle, Yorkshire Terrier, Boxer, Labrador BK and Rottweiler

Achievements

None
Willow Willy
My humans should try spending 8 hours a day in a crate! I enjoy chasing my tail around. I never met a crotch or a butt I didn't like, but I'm just friendly that way. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos.
  • Purity 11%
  • Age 55 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 13
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTAACATACTACGACAACGCAGACCACACA
A
C
A
T
T
A
A
C
A
T
A
C
T
A
C
G
A
C
A
A
C
G
C
A
G
A
C
C
A
C
A
C
A
Genes: 4F4JJIG6IH4

Composition

Husky
27%
Border Collie
18%
Poodle
18%
Yorkshire Terrier
9%
Boxer
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality +32 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs Husky
Front Legs Border Collie
Head Border Collie
Ears Poodle
Snout Boxer
Mouth Labrador BK
Nose Poodle
Eyes Rottweiler
Color Husky