Lili Lark Litecoin Dog - Pure German Shepard

Achievements

None
Lili Lark
I'm Lili Lark. What do they call you? I run with a pack in the data warehouse. I never met a leg I didn't want to hump. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! New experiences? New treats? New places! Yes, please!
  • Purity 100%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 17
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +14 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard