Sir-Barks-Alot Susie-Q Cryptocurrency Dog - Pure German Shepard

Achievements

None
Sir-Barks-Alot Susie-Q
How YOU doin'? Sir-Barks-Alot Susie-Q here. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I'm always up for a nice long walk around the neighborhood. I hate it when humans put the lid down. The smell of fresh manure to roll in makes me wild.
  • Purity 100%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 16
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality +14 points
Lunar Effect -24 points

Traits Breakdown

Traits 100% Purebred German Shepard