Tinky Taki Digital Cryptocurrency Dog - Mix of St. Bernard, Pitbull terrier, Corgi, Husky, Boxer, Schnauzer and Maltese

Achievements

None
Tinky Taki
Tinky Taki here. Wanna play? I live in cyberspace where you can turn me on. I may need de-worming. I love fetching anything my human throws! My favorite game is Fetch except I never bring the ball back. I don't appreciate being around bores who bark too much.
  • Purity 11%
  • Age 55 days
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATGAAGCTCCACAAACATATCCTGAACCTCC
T
G
A
T
G
A
A
G
C
T
C
C
A
C
A
A
A
C
A
T
A
T
C
C
T
G
A
A
C
C
T
C
C
Genes: BBON4GCNBKN

Composition

St. Bernard
27%
Pitbull terrier
27%
Corgi
9%
Husky
9%
Boxer
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality -7 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail St. Bernard
Legs Corgi
Front Legs Pitbull terrier
Head Husky
Ears Boxer
Snout Schnauzer
Mouth Pitbull terrier
Nose St. Bernard
Eyes Maltese
Color Pitbull terrier