Nona Ned Digital Cryptocurrency Dog - Mix of Beagle, French Bulldog, Border Collie, Maltese, Pug, Yorkshire Terrier, Rottweiler and Pitbull terrier

Achievements

None
Nona Ned
Hey there... I'm Nona Ned. I cry whenever I hear an ambulance siren! I'm always up for a nice long walk around the neighborhood. Little Bow Wow is my favorite musician. I just assume he's a dog... I hate it when my human runs out of poop-bags. How embarrassing!
  • Purity 8%
  • Age 53 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACCGACTACTAACCGAATTACGACACTCC
C
T
A
T
A
C
C
G
A
C
T
A
C
T
A
A
C
C
G
A
A
T
T
A
C
G
A
C
A
C
T
C
C
Genes: DJ9DDK2F9HN

Composition

Beagle
27%
French Bulldog
18%
Border Collie
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -13 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs French Bulldog
Front Legs Beagle
Head Beagle
Ears Maltese
Snout Pug
Mouth Yorkshire Terrier
Nose French Bulldog
Eyes Rottweiler
Color Pitbull terrier

Parents

No Children