Wilbur Woofer Litecoin Dog - Mix of Boxer, Dachshund, Yorkshire Terrier, St. Bernard, Husky, Golder Retriever and French Bulldog

Achievements

None
Wilbur Woofer
How do you do? I'm Wilbur Woofer. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My favorite way to spend playtime is a good game of frisbee. I'm looking to share time together and not just to be an accessory.
  • Purity 7%
  • Age 53 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATTAAACTGAGGATTAAACACAAGAAACCGA
G
G
A
T
T
A
A
A
C
T
G
A
G
G
A
T
T
A
A
A
C
A
C
A
A
G
A
A
A
C
C
G
A
Genes: AFGBAFG48G9

Composition

Boxer
27%
Dachshund
18%
Yorkshire Terrier
18%
St. Bernard
9%
Husky
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -6 points
Lunar Effect -10 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Boxer
Front Legs St. Bernard
Head Dachshund
Ears Yorkshire Terrier
Snout Boxer
Mouth Husky
Nose Golder Retriever
Eyes Boxer
Color French Bulldog