Darla Destini Cryptocurrency Dog - Mix of Pug, St. Bernard, French Bulldog, Shiba Inu, Labrador BK and Border Collie

Achievements

None
Darla Destini
Greetings. My name is Darla Destini. Removing excess stuffing from pillows is my favorite hobby. I never knew my father. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!!
  • Purity 17%
  • Age 56 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAATGATGACGAGTACGAGCAGAATACGAA
G
A
A
G
A
A
T
G
A
T
G
A
C
G
A
G
T
A
C
G
A
G
C
A
G
A
A
T
A
C
G
A
A
Genes: 22BB9E962J2

Composition

Pug
36%
St. Bernard
18%
French Bulldog
18%
Shiba Inu
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs St. Bernard
Front Legs St. Bernard
Head French Bulldog
Ears Shiba Inu
Snout French Bulldog
Mouth Labrador BK
Nose Pug
Eyes Border Collie
Color Pug