Hermione Huey Litecoin Dog - Mix of Pug, St. Bernard, Border Collie, Shiba Inu, Husky, Poodle and French Bulldog

Achievements

None
Hermione Huey
Even living on the internet like I do, too much kibble makes my bandwidth expand. I love unconditionally. I live life by my favorite quote "Every dog has it's day", but every day is my day! Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 10%
  • Age 53 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAGTATGAGAAACAGAAGACGAATGACGA
T
A
C
G
A
A
G
T
A
T
G
A
G
A
A
A
C
A
G
A
A
G
A
C
G
A
A
T
G
A
C
G
A
Genes: J2EB242I2B9

Composition

Pug
36%
St. Bernard
18%
Border Collie
9%
Shiba Inu
9%
Husky
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality +5 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Shiba Inu
Front Legs St. Bernard
Head Pug
Ears Husky
Snout Pug
Mouth Poodle
Nose Pug
Eyes St. Bernard
Color French Bulldog