Tilly Tardis Bitcoin Game Dog - Mix of Maltese, Pitbull terrier, Rottweiler, Golder Retriever, French Bulldog, Labrador, Pug, Yorkshire Terrier and St. Bernard

Achievements

None
Tilly Tardis
Howdy there. I'm Tilly Tardis. Have you ever dated a digital creation before? I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Slipping my collar, running off and making my humans worried? Every chance I get. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur!
  • Purity 3%
  • Age 53 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCACAGATCCCGACCATCCGAAACCTTATGA
A
C
C
C
A
C
A
G
A
T
C
C
C
G
A
C
C
A
T
C
C
G
A
A
A
C
C
T
T
A
T
G
A
Genes: KH8N95N2KFB

Composition

Maltese
18%
Pitbull terrier
18%
Rottweiler
9%
Golder Retriever
9%
French Bulldog
9%
Labrador
9%
Pug
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -8 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Golder Retriever
Front Legs Pitbull terrier
Head French Bulldog
Ears Labrador
Snout Pitbull terrier
Mouth Pug
Nose Maltese
Eyes Yorkshire Terrier
Color St. Bernard

Parents

No Children