Angelina Aqua Crypto Dog - Mix of Pug, Pitbull terrier, French Bulldog, Rottweiler, Corgi and Schnauzer

Achievements

None
Angelina Aqua
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I live life by my favorite quote "Every dog has it's day", but every day is my day! Oh, go ahead. Pet me. I know you want to. I'm ready to settle down and have puppies...what about you?
  • Purity 12%
  • Age 56 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACACGAATCCTCCGAATCCGAACGAAGCATA
C
G
A
C
A
C
G
A
A
T
C
C
T
C
C
G
A
A
T
C
C
G
A
A
C
G
A
A
G
C
A
T
A
Genes: 9H2NN2N29OC

Composition

Pug
27%
Pitbull terrier
27%
French Bulldog
18%
Rottweiler
9%
Corgi
9%
Schnauzer
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Rottweiler
Legs Pug
Front Legs Pitbull terrier
Head Pitbull terrier
Ears Pug
Snout Pitbull terrier
Mouth Pug
Nose French Bulldog
Eyes Corgi
Color Schnauzer

Parents

No Children