June June Bug Digital Cryptocurrency Dog - Mix of French Bulldog, Pug, Border Collie, Husky, Pitbull terrier, Shiba Inu, Yorkshire Terrier and Boxer

Achievements

None
June June Bug
Barkjour mi amor! I'm June June Bug. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 4%
  • Age 53 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAACAGAACGATCCGTATACTTATACGAAAAC
C
G
A
A
C
A
G
A
A
C
G
A
T
C
C
G
T
A
T
A
C
T
T
A
T
A
C
G
A
A
A
A
C
Genes: 9429NEJFJ2G

Composition

French Bulldog
18%
Pug
18%
Border Collie
18%
Husky
9%
Pitbull terrier
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -11 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail Husky
Legs Pug
Front Legs French Bulldog
Head Pitbull terrier
Ears Shiba Inu
Snout Border Collie
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Pug
Color Boxer