Einstein Eva Digital Cryptocurrency Game Dog - Mix of Pug, Husky, Boxer, French Bulldog, Border Collie, Poodle, Shiba Inu, Labrador, Labrador BK and St. Bernard

Achievements

None
Einstein Eva
What's up, dog? I'm Einstein Eva! If I can't reach it to clean it myself, it doesn't need cleaning! I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I want a mate that knows how to give a proper belly rub!
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAACCGATACGACGTACCAGAAGAAGCATGA
A
C
A
A
A
C
C
G
A
T
A
C
G
A
C
G
T
A
C
C
A
G
A
A
G
A
A
G
C
A
T
G
A
Genes: 4G9JIE5226B

Composition

Pug
18%
Husky
9%
Boxer
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%

Current Energy

Vitality -23 points
Lunar Effect -6 points

Traits Breakdown

Body Husky
Tail Boxer
Legs French Bulldog
Front Legs Border Collie
Head Poodle
Ears Shiba Inu
Snout Labrador
Mouth Pug
Nose Pug
Eyes Labrador BK
Color St. Bernard

Parents

No Children