T-Bone Tywin Litecoin Dog - Mix of Golder Retriever, Pug, French Bulldog, Dachshund, St. Bernard, Beagle and Yorkshire Terrier

Achievements

None
T-Bone Tywin
Suh...you good? T-Bone Tywin here. I'd like to take you for a byte to eat in cyberspace. My favorite way to relax is to be scratched on my belly. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGAACGAAGATGAGAAGGACGACTATTAGGA
A
G
A
G
A
A
C
G
A
A
G
A
T
G
A
G
A
A
G
G
A
C
G
A
C
T
A
T
T
A
G
G
A
Genes: 8298B2A9DFA

Composition

Golder Retriever
18%
Pug
18%
French Bulldog
18%
Dachshund
18%
St. Bernard
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality +5 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Pug
Legs French Bulldog
Front Legs Golder Retriever
Head St. Bernard
Ears Pug
Snout Dachshund
Mouth French Bulldog
Nose Beagle
Eyes Yorkshire Terrier
Color Dachshund

Parents

No Children