Little-Rascal Lumiere Digital Cryptocurrency Game Dog - Mix of Husky, Corgi, Yorkshire Terrier, German Shepard, Maltese, Poodle, Schnauzer and Beagle

Achievements

None
Little-Rascal Lumiere
Currently, I live on the information superhighway. I love it when you show a little teeth. I like to respond to sad puppy eyes with sad puppy eyes of my own. I don't appreciate being around bores who bark too much. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCACATCATTATTAACCGACAGCATACTA
A
C
A
A
G
C
A
C
A
T
C
A
T
T
A
T
T
A
A
C
C
G
A
C
A
G
C
A
T
A
C
T
A
Genes: 4O47FFKIOCD

Composition

Husky
18%
Corgi
18%
Yorkshire Terrier
18%
German Shepard
9%
Maltese
9%
Poodle
9%
Schnauzer
9%
Beagle
9%

Current Energy

Vitality +17 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Husky
Front Legs German Shepard
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Maltese
Mouth Poodle
Nose Corgi
Eyes Schnauzer
Color Beagle

Parents

No Children