Kiki Kiwi Litecoin Dog - Mix of Boxer, Pug, Shiba Inu, Golder Retriever, Maltese and Rottweiler

Achievements

None
Kiki Kiwi
Let me introduce myself, I'm Kiki Kiwi. Have you ever dated a digital creation before? Sometimes I forget where I buried my bone. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I just want to share a ball with someone, if you know what I mean...
  • Purity 15%
  • Age 56 days
  • Racing Exp 0
  • Boxer 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGTAAACAACGAAAACGAAAGAACCGAACAC
A
A
C
G
T
A
A
A
C
A
A
C
G
A
A
A
A
C
G
A
A
A
G
A
A
C
C
G
A
A
C
A
C
Genes: GEGG2G28K2H

Composition

Boxer
36%
Pug
27%
Shiba Inu
9%
Golder Retriever
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Shiba Inu
Legs Boxer
Front Legs Boxer
Head Pug
Ears Boxer
Snout Pug
Mouth Golder Retriever
Nose Maltese
Eyes Pug
Color Rottweiler