Lynx Lacie Cryptocurrency Game Dog - Mix of Pitbull terrier, Boxer, Rottweiler, Dachshund, St. Bernard, Border Collie, Pug, Yorkshire Terrier, Husky and Golder Retriever

Achievements

None
Lynx Lacie
Taking a break from chasing Nyan Cat around cyberspace. I cry whenever I hear an ambulance siren! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 1%
  • Age 56 days
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCACTCCGGATGATACGAATTATCCACAAGA
A
A
C
C
A
C
T
C
C
G
G
A
T
G
A
T
A
C
G
A
A
T
T
A
T
C
C
A
C
A
A
G
A
Genes: GHNABJ2FN48

Composition

Pitbull terrier
18%
Boxer
9%
Rottweiler
9%
Dachshund
9%
St. Bernard
9%
Border Collie
9%
Pug
9%
Yorkshire Terrier
9%
Husky
9%
Golder Retriever
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Rottweiler
Legs Pitbull terrier
Front Legs Dachshund
Head St. Bernard
Ears Border Collie
Snout Pug
Mouth Yorkshire Terrier
Nose Pitbull terrier
Eyes Husky
Color Golder Retriever