Sven Skeeter Digital Cryptocurrency Dog - Mix of Maltese, Yorkshire Terrier, Corgi, Grey Wolf, Shiba Inu, Schnauzer, St. Bernard, Pitbull terrier, German Shepard and Pug

Achievements

None
Sven Skeeter
Howdy there. I'm Sven Skeeter. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I'm into leather...if I have the right partner. You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAAGCACCACCCCCGTAATATGATCCTCAGAA
T
T
A
A
G
C
A
C
C
A
C
C
C
C
C
G
T
A
A
T
A
T
G
A
T
C
C
T
C
A
G
A
A
Genes: FOKKLECBN72

Composition

Maltese
18%
Yorkshire Terrier
9%
Corgi
9%
Grey Wolf
9%
Shiba Inu
9%
Schnauzer
9%
St. Bernard
9%
Pitbull terrier
9%
German Shepard
9%
Pug
9%

Current Energy

Vitality -23 points
Lunar Effect -12 points

Traits Breakdown

Body Yorkshire Terrier
Tail Corgi
Legs Maltese
Front Legs Maltese
Head Grey Wolf
Ears Shiba Inu
Snout Schnauzer
Mouth St. Bernard
Nose Pitbull terrier
Eyes German Shepard
Color Pug

Parents

No Children