Boomer Boba Fett Cryptocurrency Dog - Mix of Yorkshire Terrier, Maltese, German Shepard, French Bulldog, Husky, Pitbull terrier, Corgi, Dachshund, Border Collie and Labrador

Achievements

None
Boomer Boba Fett
If you'd like to get together, I'm Boomer Boba Fett. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I like to work out by digging fresh holes in landscaped yards. I'm always up for some puppy action, is that wrong?
  • Purity 1%
  • Age 53 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTCACGAACATCCTTAAGCGGATACCCATTA
A
C
C
T
C
A
C
G
A
A
C
A
T
C
C
T
T
A
A
G
C
G
G
A
T
A
C
C
C
A
T
T
A
Genes: K794NFOAJ5F

Composition

Yorkshire Terrier
18%
Maltese
9%
German Shepard
9%
French Bulldog
9%
Husky
9%
Pitbull terrier
9%
Corgi
9%
Dachshund
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -6 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs French Bulldog
Front Legs Husky
Head Pitbull terrier
Ears Yorkshire Terrier
Snout Corgi
Mouth Dachshund
Nose Border Collie
Eyes Labrador
Color Yorkshire Terrier

Parents

No Children