Ferrari Flora Cryptocurrency Game Dog - Mix of Pitbull terrier, Golder Retriever, Beagle, Poodle, Shiba Inu, Dachshund, Yorkshire Terrier and Corgi

Achievements

None
Ferrari Flora
Whatcha know, honey. Ferrari Flora here. The Ethernet where I live, rocks. Air Bud is definitely my favorite movie. What a role model! Don't bother contacting me if you like cats. Once I caught a seagull, but it scared me so I let it go. I enjoy crunchy kibble and drinking from toilets.
  • Purity 8%
  • Age 53 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCAGACTATCCAGAGACGTAGGATTAAGC
T
C
C
T
C
C
A
G
A
C
T
A
T
C
C
A
G
A
G
A
C
G
T
A
G
G
A
T
T
A
A
G
C
Genes: NN8DN8IEAFO

Composition

Pitbull terrier
27%
Golder Retriever
18%
Beagle
9%
Poodle
9%
Shiba Inu
9%
Dachshund
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality -3 points
Lunar Effect -14 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Golder Retriever
Front Legs Beagle
Head Pitbull terrier
Ears Golder Retriever
Snout Poodle
Mouth Shiba Inu
Nose Dachshund
Eyes Yorkshire Terrier
Color Corgi