Libby Littlefinger Litecoin Game Dog - Mix of Shiba Inu, Boxer, Pug, Maltese, St. Bernard, Rottweiler, Golder Retriever and Pitbull terrier

Achievements

None
Libby Littlefinger
Hey, good-looking! This is Libby Littlefinger. I'm 100% digital, baby. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I like nibbling on most everything, but I'll bite if you want me to. I 'm here for something RUFF ;)
  • Purity 12%
  • Age 56 days
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGAAGTAACCTGACACGTAGTAGTAAGATCC
A
A
C
G
A
A
G
T
A
A
C
C
T
G
A
C
A
C
G
T
A
G
T
A
G
T
A
A
G
A
T
C
C
Genes: G2EKBHEEE8N

Composition

Shiba Inu
36%
Boxer
9%
Pug
9%
Maltese
9%
St. Bernard
9%
Rottweiler
9%
Golder Retriever
9%
Pitbull terrier
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Pug
Legs Shiba Inu
Front Legs Maltese
Head St. Bernard
Ears Rottweiler
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Golder Retriever
Color Pitbull terrier