Nibby Ninja Digital Cryptocurrency Game Dog - Mix of Dachshund, Border Collie, Yorkshire Terrier, St. Bernard, Shiba Inu, Beagle, Husky and Maltese

Achievements

None
Nibby Ninja
I'm all about a hard drive because you can't do anything with a floppy disc. Chasing anything that will run is so much fun, I could do that all day. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later!
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATACTGAGGAGTACTATACACAACCTTATTA
G
G
A
T
A
C
T
G
A
G
G
A
G
T
A
C
T
A
T
A
C
A
C
A
A
C
C
T
T
A
T
T
A
Genes: AJBAEDJ4KFF

Composition

Dachshund
18%
Border Collie
18%
Yorkshire Terrier
18%
St. Bernard
9%
Shiba Inu
9%
Beagle
9%
Husky
9%
Maltese
9%

Current Energy

Vitality +2 points
Lunar Effect +10 points

Traits Breakdown

Body Dachshund
Tail Border Collie
Legs St. Bernard
Front Legs Dachshund
Head Shiba Inu
Ears Beagle
Snout Border Collie
Mouth Husky
Nose Maltese
Eyes Yorkshire Terrier
Color Yorkshire Terrier

Parents

No Children