Tani Tasha Litecoin Dog - Mix of Rottweiler, St. Bernard, Golder Retriever, Yorkshire Terrier, Border Collie, Corgi, Maltese, Shiba Inu, Pitbull terrier and Dachshund

Achievements

None
Tani Tasha
Good day to you! I'm Tani Tasha! I run exclusively on code. I'm going kill that damn Nyan Cat if I can catch it. I love unconditionally. Blue toilet water turns me off. My favorite treat is to steal the pepperoni off of pizza. I just want a snuggle buddy with a nice, soft coat.
  • Purity 1%
  • Age 56 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGAAGACACTTATACAGCACCGTATCCGGA
C
A
C
T
G
A
A
G
A
C
A
C
T
T
A
T
A
C
A
G
C
A
C
C
G
T
A
T
C
C
G
G
A
Genes: HB8HFJOKENA

Composition

Rottweiler
18%
St. Bernard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Border Collie
9%
Corgi
9%
Maltese
9%
Shiba Inu
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Golder Retriever
Front Legs Rottweiler
Head Yorkshire Terrier
Ears Border Collie
Snout Corgi
Mouth Maltese
Nose Shiba Inu
Eyes Pitbull terrier
Color Dachshund