Nola Nightwolf Digital Cryptocurrency Game Dog - Mix of Dachshund, Border Collie, Pug, Grey Wolf, Maltese, Schnauzer and Golder Retriever

Achievements

None
Nola Nightwolf
I never met a leg I didn't want to hump. I hate having to wear foo-foo clothes and ribbons in my fur. My favorite way to relax is to be scratched on my belly. I love unconditionally. New experiences? New treats? New places! Yes, please!
  • Purity 11%
  • Age 56 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGAAGGACCCTACTACACCTACGGAATAAGA
G
G
A
G
A
A
G
G
A
C
C
C
T
A
C
T
A
C
A
C
C
T
A
C
G
G
A
A
T
A
A
G
A
Genes: A2ALJJKJAC8

Composition

Dachshund
27%
Border Collie
27%
Pug
9%
Grey Wolf
9%
Maltese
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality +14 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Dachshund
Front Legs Grey Wolf
Head Border Collie
Ears Border Collie
Snout Maltese
Mouth Border Collie
Nose Dachshund
Eyes Schnauzer
Color Golder Retriever