Flash Fifi Litecoin Game Dog - Mix of Dachshund, Pug, Husky, Shiba Inu, Golder Retriever and French Bulldog

Achievements

None
Flash Fifi
Hello, there. Flash Fifi here. I like never worrying about my dog poo. I've got people for that. I've had my nose rubbed in 'it' more than once. I hate having to share my food dish... I want someone who can show me a good time; I'll do the same for you.
  • Purity 23%
  • Age 53 days
  • Racing Exp 0
  • Dachshund 45%
  • 0 races
  • Gen 18
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAACAGTAGAAGAAGGAGGAAGACGA
G
G
A
G
G
A
G
G
A
A
C
A
G
T
A
G
A
A
G
A
A
G
G
A
G
G
A
A
G
A
C
G
A
Genes: AAA4E22AA89

Composition

Dachshund
45%
Pug
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality +4 points
Lunar Effect -20 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color French Bulldog

Parents

No Children