Dave Dino Crypto Game Dog - Mix of Dachshund, Husky, Border Collie and German Shepard

Achievements

None
Dave Dino
Eat, sleep, poop. Honey, I've got it made. I hate not being allowed to hunt treasure in the garbage. It smells so good! I love a good book... I find them quite tasty. I love it when you show a little teeth.
  • Purity 41%
  • Age 53 days
  • Racing Exp 0
  • Dachshund 64%
  • 0 races
  • Gen 9
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCAACAGGAGGAGGAACAGGAGGAGGAGGA
T
A
C
T
C
A
A
C
A
G
G
A
G
G
A
G
G
A
A
C
A
G
G
A
G
G
A
G
G
A
G
G
A
Genes: J74AAA4AAAA

Composition

Dachshund
64%
Husky
18%
Border Collie
9%
German Shepard
9%

Current Energy

Vitality +8 points
Lunar Effect -16 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Husky
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Husky
Mouth Dachshund
Nose Dachshund
Eyes Dachshund
Color Dachshund