Akita Alyssa Bitcoin Dog - Mix of Shiba Inu, Beagle, German Shepard, St. Bernard, French Bulldog, Border Collie, Corgi and Grey Wolf

Achievements

None
Akita Alyssa
Hi! My name is Akita Alyssa. The absolute best time of day is dinner time! My humans say I slobber too much, but hey, I'm just juicy. Shy dogs that tuck tail bore me. I really enjoy heavy petting. If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCAGTATGAGTACGAGTAGTATACAGCCCC
C
T
A
T
C
A
G
T
A
T
G
A
G
T
A
C
G
A
G
T
A
G
T
A
T
A
C
A
G
C
C
C
C
Genes: D7EBE9EEJOL

Composition

Shiba Inu
36%
Beagle
9%
German Shepard
9%
St. Bernard
9%
French Bulldog
9%
Border Collie
9%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality -23 points
Lunar Effect +10 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Shiba Inu
Front Legs St. Bernard
Head Shiba Inu
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose Border Collie
Eyes Corgi
Color Grey Wolf

Parents

No Children