Oracle Ophelia Bitcoin Dog - Mix of St. Bernard, French Bulldog, Dachshund, Corgi, Husky, German Shepard, Schnauzer, Beagle, Maltese and Pitbull terrier

Achievements

None
Oracle Ophelia
Someday I'm gonna breakout from inside this server. I love it when you show a little teeth. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Being able to lick myself is nice, but I want to find my special someone.
  • Purity 1%
  • Age 53 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGATGAGGAAGCACATCAATACTATGAACCTCC
C
G
A
T
G
A
G
G
A
A
G
C
A
C
A
T
C
A
A
T
A
C
T
A
T
G
A
A
C
C
T
C
C
Genes: 9BAO47CDBKN

Composition

St. Bernard
18%
French Bulldog
9%
Dachshund
9%
Corgi
9%
Husky
9%
German Shepard
9%
Schnauzer
9%
Beagle
9%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality -2 points
Lunar Effect +6 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Dachshund
Front Legs Corgi
Head Husky
Ears German Shepard
Snout Schnauzer
Mouth Beagle
Nose St. Bernard
Eyes Maltese
Color Pitbull terrier