Dino Doug Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Corgi, Beagle, Boxer, Pitbull terrier and Schnauzer

Achievements

None
Dino Doug
I'm all about a hard drive because you can't do anything with a floppy disc. I enjoy destroying a nice fresh pair of slippers. I am not above stealing food off humans' plates. What's your favorite bed? Mine is the dirty laundry. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.
  • Purity 13%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCCAGCTTACTACTATTAATATTAAGCTTA
A
A
C
T
C
C
A
G
C
T
T
A
C
T
A
C
T
A
T
T
A
A
T
A
T
T
A
A
G
C
T
T
A
Genes: GNOFDDFCFOF

Composition

Yorkshire Terrier
36%
Corgi
18%
Beagle
18%
Boxer
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -8 points
Lunar Effect +2 points

Traits Breakdown

Body Boxer
Tail Pitbull terrier
Legs Corgi
Front Legs Yorkshire Terrier
Head Beagle
Ears Beagle
Snout Yorkshire Terrier
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Corgi
Color Yorkshire Terrier

Parents

No Children