Oakley Olympus Litecoin Dog - Mix of Shiba Inu, Golder Retriever, Rottweiler and Pitbull terrier

Achievements

None
Oakley Olympus
Well hello, beautiful. My name's Oakley Olympus. I'm not a bad dog, my data is just configured that way. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I've had my nose rubbed in 'it' more than once.
  • Purity 28%
  • Age 53 days
  • Racing Exp 0
  • Shiba Inu 45%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAGACACTCCGTAGTAGTAGTACACAGAAGA
G
T
A
A
G
A
C
A
C
T
C
C
G
T
A
G
T
A
G
T
A
G
T
A
C
A
C
A
G
A
A
G
A
Genes: E8HNEEEEH88

Composition

Shiba Inu
45%
Golder Retriever
27%
Rottweiler
18%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Rottweiler
Front Legs Pitbull terrier
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever