Jesse James Jessie Bitcoin Dog - Mix of Pug, Grey Wolf, Beagle, Maltese, Dachshund, Border Collie, Yorkshire Terrier, German Shepard, Labrador and Shiba Inu

Achievements

None
Jesse James Jessie
I'm not a fan of sleeping on the floor. This body was made for cuddles! When my human brushes my coat, I get frisky! Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCTAACCGGATACTTATCACCAGTAGAAGAA
C
C
C
C
T
A
A
C
C
G
G
A
T
A
C
T
T
A
T
C
A
C
C
A
G
T
A
G
A
A
G
A
A
Genes: LDKAJF75E22

Composition

Pug
18%
Grey Wolf
9%
Beagle
9%
Maltese
9%
Dachshund
9%
Border Collie
9%
Yorkshire Terrier
9%
German Shepard
9%
Labrador
9%
Shiba Inu
9%

Current Energy

Vitality +4 points
Lunar Effect -4 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Maltese
Front Legs Dachshund
Head Border Collie
Ears Yorkshire Terrier
Snout German Shepard
Mouth Labrador
Nose Shiba Inu
Eyes Pug
Color Pug