Jane Jenna Crypto Dog - Mix of Beagle, Labrador, Boxer, Dachshund, Border Collie, Rottweiler, Maltese, Shiba Inu and Pitbull terrier

Achievements

None
Jane Jenna
If you'd like to get together, I'm Jane Jenna. I hate it when humans put the lid down. I think hamsters and cats are both over-rated. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 3%
  • Age 56 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCTACCAGGATACCTACACCCAACCGTATCC
A
A
C
C
T
A
C
C
A
G
G
A
T
A
C
C
T
A
C
A
C
C
C
A
A
C
C
G
T
A
T
C
C
Genes: GD5AJDH5KEN

Composition

Beagle
18%
Labrador
18%
Boxer
9%
Dachshund
9%
Border Collie
9%
Rottweiler
9%
Maltese
9%
Shiba Inu
9%
Pitbull terrier
9%

Current Energy

Vitality +16 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Beagle
Legs Labrador
Front Legs Dachshund
Head Border Collie
Ears Beagle
Snout Rottweiler
Mouth Labrador
Nose Maltese
Eyes Shiba Inu
Color Pitbull terrier