Bullet Bridgette Bitcoin Game Dog - Mix of French Bulldog, Golder Retriever, Husky, Yorkshire Terrier, Border Collie, Corgi, Shiba Inu and Pug

Achievements

None
Bullet Bridgette
I work in The Virtual Machine. I hate not being allowed to hunt treasure in the garbage. It smells so good! When my human brushes my coat, I get frisky! I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I believe running along the beach to catch a stick can be nearly orgasmic.
  • Purity 9%
  • Age 53 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGAAGAAGATTATACCGACGAAGCGTAGAA
A
C
A
C
G
A
A
G
A
A
G
A
T
T
A
T
A
C
C
G
A
C
G
A
A
G
C
G
T
A
G
A
A
Genes: 4988FJ99OE2

Composition

French Bulldog
27%
Golder Retriever
18%
Husky
9%
Yorkshire Terrier
9%
Border Collie
9%
Corgi
9%
Shiba Inu
9%
Pug
9%

Current Energy

Vitality +21 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Golder Retriever
Front Legs Golder Retriever
Head Yorkshire Terrier
Ears Border Collie
Snout French Bulldog
Mouth French Bulldog
Nose Corgi
Eyes Shiba Inu
Color Pug