Precious Pinocchio Cryptocurrency Game Dog - Mix of Pug, Pitbull terrier, Husky, Shiba Inu, Border Collie and Rottweiler

Achievements

None
Precious Pinocchio
I hate having to wear foo-foo clothes and ribbons in my fur. My 'G' spot is under my chin...scratch me there and I'll growl softly. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...
  • Purity 21%
  • Age 56 days
  • Racing Exp 0
  • Pug 45%
  • 0 races
  • Gen 6
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGAAGAAACAGTATACTCCCACGAAGAAGAA
T
C
C
G
A
A
G
A
A
A
C
A
G
T
A
T
A
C
T
C
C
C
A
C
G
A
A
G
A
A
G
A
A
Genes: N224EJNH222

Composition

Pug
45%
Pitbull terrier
18%
Husky
9%
Shiba Inu
9%
Border Collie
9%
Rottweiler
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Pug
Front Legs Husky
Head Shiba Inu
Ears Border Collie
Snout Pitbull terrier
Mouth Rottweiler
Nose Pug
Eyes Pug
Color Pug