Breeze Beta Crypto Game Dog - Mix of St. Bernard, Husky, Boxer, Rottweiler, Grey Wolf, Pitbull terrier, French Bulldog and Corgi

Achievements

None
Breeze Beta
Hi, I'm Breeze Beta. Here in cyberspace, I ain't got much use for a floppy disc. My favorite treat is to steal the pepperoni off of pizza. Dragging my butt on the carpet feels so good. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 6%
  • Age 53 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGACCCTCCTGAACAACAAACCGAAGCAAC
C
A
C
T
G
A
C
C
C
T
C
C
T
G
A
A
C
A
A
C
A
A
A
C
C
G
A
A
G
C
A
A
C
Genes: HBLNB44G9OG

Composition

St. Bernard
18%
Husky
18%
Boxer
18%
Rottweiler
9%
Grey Wolf
9%
Pitbull terrier
9%
French Bulldog
9%
Corgi
9%

Current Energy

Vitality +12 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Grey Wolf
Front Legs Pitbull terrier
Head St. Bernard
Ears Husky
Snout Husky
Mouth Boxer
Nose French Bulldog
Eyes Corgi
Color Boxer