Dory Deputy Dawg Bitcoin Dog - Mix of Corgi, Maltese, Rottweiler, Golder Retriever, Shiba Inu, Pug and Pitbull terrier

Achievements

None
Dory Deputy Dawg
Hey! Call me Dory Deputy Dawg. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I really enjoy heavy petting. I'll lick anything. I don't like running outta pee when there are still so many trees.
  • Purity 9%
  • Age 53 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAGCAGCGTAACCCACGAAACCTCCAGCCAC
A
G
A
A
G
C
A
G
C
G
T
A
A
C
C
C
A
C
G
A
A
A
C
C
T
C
C
A
G
C
C
A
C
Genes: 8OOEKH2KNOH

Composition

Corgi
27%
Maltese
18%
Rottweiler
18%
Golder Retriever
9%
Shiba Inu
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect +2 points

Traits Breakdown

Body Golder Retriever
Tail Corgi
Legs Corgi
Front Legs Shiba Inu
Head Maltese
Ears Rottweiler
Snout Pug
Mouth Maltese
Nose Pitbull terrier
Eyes Corgi
Color Rottweiler

Parents

No Children