Cain Charlie Brown Crypto Dog - Mix of Dachshund, Golder Retriever, St. Bernard, Boxer, Pitbull terrier, Corgi, Yorkshire Terrier and Labrador BK

Achievements

None
Cain Charlie Brown
Hola! My name is Cain Charlie Brown. Ima Ethernet dog. People food disagrees with me. Whew! You can tell. I don't like having to stay off the furniture. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAAGAAGATGAGGAAACTCCAGCTTAGGAGCA
G
G
A
A
G
A
A
G
A
T
G
A
G
G
A
A
A
C
T
C
C
A
G
C
T
T
A
G
G
A
G
C
A
Genes: A88BAGNOFA6

Composition

Dachshund
27%
Golder Retriever
18%
St. Bernard
9%
Boxer
9%
Pitbull terrier
9%
Corgi
9%
Yorkshire Terrier
9%
Labrador BK
9%

Current Energy

Vitality 0 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Golder Retriever
Legs Golder Retriever
Front Legs St. Bernard
Head Dachshund
Ears Boxer
Snout Pitbull terrier
Mouth Corgi
Nose Yorkshire Terrier
Eyes Dachshund
Color Labrador BK