Pugsley Phantom Litecoin Dog - Mix of Pug, Shiba Inu, Corgi, French Bulldog, Poodle and Beagle

Achievements

None
Pugsley Phantom
I run with a pack in the data warehouse. I never met a leg I didn't want to hump. My favorite place in the world is the dog park. So many smells! I like to play fetch with a tennis ball. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Getting out of a long relationship, not looking for another
  • Purity 20%
  • Age 56 days
  • Racing Exp 0
  • Pug 45%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAGCGAACGAGTAGAAGACCTAGTAGAAGAA
G
A
A
A
G
C
G
A
A
C
G
A
G
T
A
G
A
A
G
A
C
C
T
A
G
T
A
G
A
A
G
A
A
Genes: 2O29E2IDE22

Composition

Pug
45%
Shiba Inu
18%
Corgi
9%
French Bulldog
9%
Poodle
9%
Beagle
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Corgi
Legs Pug
Front Legs French Bulldog
Head Shiba Inu
Ears Pug
Snout Poodle
Mouth Beagle
Nose Shiba Inu
Eyes Pug
Color Pug