Chelsea Cyrano Litecoin Game Dog - Mix of Husky, St. Bernard, Schnauzer, Corgi, Boxer, Border Collie, Shiba Inu, Labrador BK and Labrador

Achievements

None
Chelsea Cyrano
My name is Chelsea Cyrano and I do tricks. I like exploring off leash best. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I have a crush on the Grumpy cat. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 3%
  • Age 54 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAAGCACATGAAACACATACGTAGCATGACCA
A
T
A
A
G
C
A
C
A
T
G
A
A
A
C
A
C
A
T
A
C
G
T
A
G
C
A
T
G
A
C
C
A
Genes: CO4BG4JE6B5

Composition

Husky
18%
St. Bernard
18%
Schnauzer
9%
Corgi
9%
Boxer
9%
Border Collie
9%
Shiba Inu
9%
Labrador BK
9%
Labrador
9%

Current Energy

Vitality +3 points
Lunar Effect +10 points

Traits Breakdown

Body Schnauzer
Tail Corgi
Legs Husky
Front Legs St. Bernard
Head Boxer
Ears Husky
Snout Border Collie
Mouth Shiba Inu
Nose Labrador BK
Eyes St. Bernard
Color Labrador

Parents

No Children