Flo Frank West Digital Cryptocurrency Dog - Mix of Corgi, St. Bernard, Pug, Dachshund, Labrador, German Shepard, Maltese and Pitbull terrier

Achievements

None
Flo Frank West
I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 4%
  • Age 56 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 7
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCGGACCATGAGAATCAACCTCCGAAAGCTGA
A
G
C
G
G
A
C
C
A
T
G
A
G
A
A
T
C
A
A
C
C
T
C
C
G
A
A
A
G
C
T
G
A
Genes: OA5B27KN2OB

Composition

Corgi
18%
St. Bernard
18%
Pug
18%
Dachshund
9%
Labrador
9%
German Shepard
9%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality -2 points
Lunar Effect -8 points

Traits Breakdown

Body Corgi
Tail Dachshund
Legs Labrador
Front Legs St. Bernard
Head Pug
Ears German Shepard
Snout Maltese
Mouth Pitbull terrier
Nose Pug
Eyes Corgi
Color St. Bernard

Parents

No Children