Argus Arya Crypto Dog - Mix of Maltese, Dachshund, Grey Wolf, Corgi, Beagle, Schnauzer, Labrador BK, Border Collie and Husky

Achievements

None
Argus Arya
Sup? ;-) I'm Argus Arya. Hope you like the smell of wet fur, because I'll jump into any water I see! I hate bubble baths; mud puddles are more my style. My bark alone scares birds out of my yard. I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 5%
  • Age 56 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCCCAGCCTAATAGCAGGAGGATACACCACA
A
C
C
C
C
C
A
G
C
C
T
A
A
T
A
G
C
A
G
G
A
G
G
A
T
A
C
A
C
C
A
C
A
Genes: KLODC6AAJK4

Composition

Maltese
18%
Dachshund
18%
Grey Wolf
9%
Corgi
9%
Beagle
9%
Schnauzer
9%
Labrador BK
9%
Border Collie
9%
Husky
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Grey Wolf
Legs Corgi
Front Legs Beagle
Head Schnauzer
Ears Labrador BK
Snout Dachshund
Mouth Dachshund
Nose Border Collie
Eyes Maltese
Color Husky

Parents

No Children