Fumble Fumble Bitcoin Dog - Mix of Dachshund, Boxer, Shiba Inu, Border Collie, St. Bernard, Pug and Golder Retriever

Achievements

None
Fumble Fumble
I make the best virtual pet. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I don't mind sharing my bed with someone I just met, if we can cuddle. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 12%
  • Age 56 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAAACAACGTATACAACTGAGGAGGAGAAAGA
G
G
A
A
A
C
A
A
C
G
T
A
T
A
C
A
A
C
T
G
A
G
G
A
G
G
A
G
A
A
A
G
A
Genes: AGGEJGBAA28

Composition

Dachshund
27%
Boxer
27%
Shiba Inu
9%
Border Collie
9%
St. Bernard
9%
Pug
9%
Golder Retriever
9%

Current Energy

Vitality +7 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Boxer
Legs Boxer
Front Legs Shiba Inu
Head Border Collie
Ears Boxer
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Pug
Color Golder Retriever

Parents

No Children