Maverick Mckenzie Cryptocurrency Dog - Mix of Pug, Corgi, Beagle and Boxer

Achievements

None
Maverick Mckenzie
Hello there, my name is Maverick Mckenzie. I work in The Virtual Machine. Too much steak gives me the runs! I really enjoy heavy petting. I hate bubble baths; mud puddles are more my style. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 31%
  • Age 56 days
  • Racing Exp 0
  • Pug 45%
  • 0 races
  • Gen 8
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAAGCAGCAGCCTAGAAAACGAAAGC
G
A
A
G
A
A
G
A
A
A
G
C
A
G
C
A
G
C
C
T
A
G
A
A
A
A
C
G
A
A
A
G
C
Genes: 222OOOD2G2O

Composition

Pug
45%
Corgi
36%
Beagle
9%
Boxer
9%

Current Energy

Vitality -28 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Beagle
Mouth Pug
Nose Boxer
Eyes Pug
Color Corgi

Parents

No Children