Percy Pockets Cryptocurrency Game Dog - Mix of Husky, Corgi, Grey Wolf, Boxer, St. Bernard, Dachshund, Labrador, Yorkshire Terrier and German Shepard

Achievements

None
Percy Pockets
I'm Percy Pockets. How goes it? I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. If I can't reach it to clean it myself, it doesn't need cleaning! Squeaky toys are the best, don't you agree? I like never worrying about my dog poo. I've got people for that.
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACAACACCCAACTGAGGACCATTATCAACA
A
G
C
A
C
A
A
C
A
C
C
C
A
A
C
T
G
A
G
G
A
C
C
A
T
T
A
T
C
A
A
C
A
Genes: O44LGBA5F74

Composition

Husky
27%
Corgi
9%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Dachshund
9%
Labrador
9%
Yorkshire Terrier
9%
German Shepard
9%

Current Energy

Vitality +9 points
Lunar Effect -12 points

Traits Breakdown

Body Corgi
Tail Husky
Legs Husky
Front Legs Grey Wolf
Head Boxer
Ears St. Bernard
Snout Dachshund
Mouth Labrador
Nose Yorkshire Terrier
Eyes German Shepard
Color Husky

Parents

No Children