Huey Hairy Paw-ter Litecoin Dog - Mix of Yorkshire Terrier, Maltese, Rottweiler, St. Bernard, Golder Retriever, French Bulldog, Boxer, German Shepard, Schnauzer and Pitbull terrier

Achievements

None
Huey Hairy Paw-ter
I live in your digital dreams. I enjoy mixing it up once in a while by visiting different dog parks. They say my bite is worse than my bark. I'm not a fan of sleeping on the floor. This body was made for cuddles! I need someone that "brings home the bacon"!
  • Purity 1%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCACTTATGAAGACGAAACTCATTAATATCC
A
C
C
C
A
C
T
T
A
T
G
A
A
G
A
C
G
A
A
A
C
T
C
A
T
T
A
A
T
A
T
C
C
Genes: KHFB89G7FCN

Composition

Yorkshire Terrier
18%
Maltese
9%
Rottweiler
9%
St. Bernard
9%
Golder Retriever
9%
French Bulldog
9%
Boxer
9%
German Shepard
9%
Schnauzer
9%
Pitbull terrier
9%

Current Energy

Vitality -30 points
Lunar Effect -8 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Golder Retriever
Ears French Bulldog
Snout Boxer
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Schnauzer
Color Pitbull terrier