Bayleaf Biddy Crypto Game Dog - Mix of Schnauzer, Golder Retriever, German Shepard, Pitbull terrier, Boxer, Dachshund and Border Collie

Achievements

None
Bayleaf Biddy
How you doin? ;) Bayleaf Biddy here. Currently, I live on the information superhighway. I have a crush on the Grumpy cat. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 18%
  • Age 54 days
  • Racing Exp 0
  • Schnauzer 45%
  • 0 races
  • Gen 12
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATCAATAATATCCAACATAATAGGATACATA
A
G
A
T
C
A
A
T
A
A
T
A
T
C
C
A
A
C
A
T
A
A
T
A
G
G
A
T
A
C
A
T
A
Genes: 87CCNGCCAJC

Composition

Schnauzer
45%
Golder Retriever
9%
German Shepard
9%
Pitbull terrier
9%
Boxer
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -2 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes Border Collie
Color Schnauzer

Parents

No Children