Sterling Sable Litecoin Dog - Mix of St. Bernard, Schnauzer, Border Collie and Labrador BK

Achievements

None
Sterling Sable
How YOU doin'? Sterling Sable here. Even living on the internet like I do, too much kibble makes my bandwidth expand. Size doesn't matter, I like 'em all. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I may need de-worming.
  • Purity 50%
  • Age 56 days
  • Racing Exp 0
  • St. Bernard 73%
  • 0 races
  • Gen 16
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATATGATACTGATGAGCATGATGATGATGATGA
A
T
A
T
G
A
T
A
C
T
G
A
T
G
A
G
C
A
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: CBJBB6BBBBB

Composition

St. Bernard
73%
Schnauzer
9%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality +4 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail St. Bernard
Legs Border Collie
Front Legs St. Bernard
Head St. Bernard
Ears Labrador BK
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard