Mack Martha Crypto Dog - Mix of Husky, German Shepard, French Bulldog, Yorkshire Terrier, Rottweiler, Dachshund and Maltese

Achievements

None
Mack Martha
My name is Mack Martha and I do tricks. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I have a crush on the Grumpy cat. My favorite way to spend playtime is a good game of frisbee.
  • Purity 9%
  • Age 54 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCATCACGACACCGATTAGGAACCTTAACA
A
C
A
T
C
A
T
C
A
C
G
A
C
A
C
C
G
A
T
T
A
G
G
A
A
C
C
T
T
A
A
C
A
Genes: 4779H9FAKF4

Composition

Husky
18%
German Shepard
18%
French Bulldog
18%
Yorkshire Terrier
18%
Rottweiler
9%
Dachshund
9%
Maltese
9%

Current Energy

Vitality +10 points
Lunar Effect -6 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs German Shepard
Front Legs French Bulldog
Head Rottweiler
Ears French Bulldog
Snout Yorkshire Terrier
Mouth Dachshund
Nose Maltese
Eyes Yorkshire Terrier
Color Husky