Candy Cyrus Litecoin Dog - Mix of Pitbull terrier, Rottweiler, French Bulldog, Golder Retriever, Boxer, Maltese, Yorkshire Terrier and Beagle

Achievements

None
Candy Cyrus
I don't like running outta pee when there are still so many trees. Forget plastic hotdogs...I'm into the classic chew toys like slippers. As a designer, I suggest low windows or couch backs next to windows without curtains. I love it when you show a little teeth.
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGATCCAGAAACCACCACACCTCCTTACTATCC
C
G
A
T
C
C
A
G
A
A
A
C
C
A
C
C
A
C
A
C
C
T
C
C
T
T
A
C
T
A
T
C
C
Genes: 9N8GHHKNFDN

Composition

Pitbull terrier
27%
Rottweiler
18%
French Bulldog
9%
Golder Retriever
9%
Boxer
9%
Maltese
9%
Yorkshire Terrier
9%
Beagle
9%

Current Energy

Vitality +4 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Pitbull terrier
Legs Golder Retriever
Front Legs Boxer
Head Rottweiler
Ears Rottweiler
Snout Maltese
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Beagle
Color Pitbull terrier