Bizzy Baller Digital Cryptocurrency Dog - Mix of Pitbull terrier, Golder Retriever, Rottweiler, French Bulldog, Corgi and Beagle

Achievements

None
Bizzy Baller
How's it going? I'm Bizzy Baller. I am a web of clouds kind of dog. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. My favorite place to sleep is under the covers between my humans. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 17%
  • Age 56 days
  • Racing Exp 0
  • Pitbull terrier 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAGAAGATCCCACCACTCCCGAAGCCTATCC
T
C
C
A
G
A
A
G
A
T
C
C
C
A
C
C
A
C
T
C
C
C
G
A
A
G
C
C
T
A
T
C
C
Genes: N88NHHN9ODN

Composition

Pitbull terrier
36%
Golder Retriever
18%
Rottweiler
18%
French Bulldog
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality +4 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pitbull terrier
Head Rottweiler
Ears Rottweiler
Snout Pitbull terrier
Mouth French Bulldog
Nose Corgi
Eyes Beagle
Color Pitbull terrier